Sciam


Clique e assine Sciam
Notícias

Frederick Sanger foi pai do sequenciamento genético

Falecido recentemente aos 95 anos, o cientista recebeu dois Prêmios Nobel 

National Institute of Health/Wikimedia Commons
FREDERICK SANGER "um homem surpreendentemente humilde, que uma vez disse: ‘Eu era apenas um cara que brincava no laboratório’ "  declarou Colin Blakemore, neurocientista da University of Oxford e ex-chefe do Conselho de Pesquisas Médicas inglês.

 
Por Ewen Callaway e Nature News Blog

Frederick Sanger, que recebeu dois Prêmios Nobel por seu trabalho com o sequenciamento de DNA e proteínas, morreu na terça-feira (19/11), de acordo com um porta-voz do Laboratório de Biologia Molecular da University of Cambridge, no Reino Unido. Ele tinha 95 anos.

O cientista recebeu o Prêmio Nobel de Química em 1958 por desenvolver um método para determinar a sequência completa de aminoácidos da insulina. Vinte e dois anos depois, o Comitê do Nobel lhe concedeu o Prêmio de Química de 1980 por descobrir uma maneira de determinar a sequência ordenada de moléculas de DNA.

Uma adaptação desse método – conhecido como sequenciamento Sanger – foi usado para sequenciar o genoma humano. Ele é o único cientista a ter recebido dois Prêmios Nobel de Química. Apenas dois outros cientistas receberam dois Prêmios Nobel nas ciências: Marie Curie (Física em 1903 e Química em 1911) e John Bardeen (Física em 1956 e 1972)

Após o anúncio de um sequenciamento preliminar do genoma humano em 2001, Sanger escreveu um ensaio para a Nature Medicine sobre a história do sequenciamento genético. “Quando nós começamos a trabalhar com DNA, eu não acredito que pensávamos em sequenciar todo o genoma humano– talvez em nossos sonhos mais ousados, mas certamente não dentro de 30 anos”, escreveu Sanger.

Suas notas arquivadas de laboratório foram publicadas pela Wellcome Collection.

 O Laboratório de Biologia Molecular (LMB) do Conselho de Pesquisas Médicas (MRC), onde Sanger passou grande parte de sua carreira, publicou um obituário com sua vida profissional. O texto também aponta que Sanger recusou ser nomeado cavaleiro porque não queria ser chamado de “Sir”.

Jeremy Farrar, o novo diretor da Wellcome Trust (que batizou seu Instituto Sanger em homenagem ao químico), publicou uma declaração: “Fiquei profundamente entristecido ao saber da morte de Fred Sanger, um dos maiores cientistas de qualquer geração e o único britânico a ter sido laureado com dois Prêmios Nobel. Podemos, com justiça, dizer que Fred foi o pai da era do genoma: seu trabalho estabeleceu as bases da capacidade humana de ler e compreender o código genético, o que revolucionou a biologia e que hoje contribui para melhorias transformadoras na saúde”.

J. Craig Venter, que teve seu trabalho de sequenciamento do genoma humano com financiamento particular criticado por Sanger por limitar o acesso [a seus resultados] – declarou:  “Um dos cientistas mais importantes do século 20! Fred Sanger morreu. Ele mudou duas vezes a direção do mundo científico”.  J. Craig Venter (@JCVenter) 20 de Novembro de 2013.

O jornalista científico e contribuinte regular da Nature, Ed Yong, publicou um tributo bastante misterioso em seu blog: “CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC”.  [NOTA: A sequência diz RIPFREDSANGER]

O neurocientista da University of Oxford e ex-chefe do MRC, Colin Blakemore, tinha isto a dizer: “Ele era um homem surpreendentemente humilde, que uma vez disse: ‘Eu era apenas um cara que brincava no laboratório’. O periódico Science corretamente descreveu Sanger como ‘a pessoa mais modesta que você poderia esperar conhecer’. Fred Sanger foi um verdadeiro heroi da ciência britânica do século 20”.

Richard Henderson, ex-diretor do LMB, declarou: “Ele era um cientista prático formidável, com excepcional julgamento e habilidade, e tinha uma maneira extremamente modesta e ao mesmo tempo encorajadora de interagir com seus colegas mais jovens. Recordo-me especialmente de um jovem cientista que pediu um conselho a Fred, que lhe disse ‘Acho que você precisa tentar com mais afinco’. O exemplo que ele deu continuará a motivar jovens cientistas mesmo agora que ele se foi”.

Este artigo foi reproduzido com permissão da revista Nature. O artigo foi publicado pela primeira vez em 20 de Novembro de 2013.